Top » Catalog » SNPs » Y18331

$18.00

Y18331
[Y18331]

Y18331
hg38 Position: ChrY:10015455..10015455
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y18331_F AGCTACTTGGGAGGGTTTGAG
Reverse Primer: Y18331_R GTTTTCAAAAACTACAAGAATCTCAGC
Reviews

Customers who bought this product also purchased
FT12603
FT12603
Y52071
Y52071
Y59595
Y59595
Y105557
Y105557
A19454
A19454
PH3414
PH3414
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies