Top » Catalog » SNPs » Y18331

$18.00

Y18331
[Y18331]

Y18331
hg38 Position: ChrY:10015455..10015455
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y18331_F AGCTACTTGGGAGGGTTTGAG
Reverse Primer: Y18331_R GTTTTCAAAAACTACAAGAATCTCAGC
Reviews

Customers who bought this product also purchased
Y90421
Y90421
Y5598
Y5598
Y39363
Y39363
A6105
A6105
BY94806
BY94806
B57
B57
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies