Top » Catalog » SNPs » A11751

$18.00

A11751
[A11751]

A11751
hg38 Position: ChrY:6848774..6848774
Ancestral: A
Derived: G
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: Below DF27 > FGC20747
Forward Primer: A11751_F AGGATCAAGATTCTATGACATTTATAAGC
Reverse Primer: A11751_R GAGAGAGGAAGAAATCTGCAGG
Reviews

Customers who bought this product also purchased
A15900
A15900
Y5075
Y5075
Y152744
Y152744
Z296
Z296
FT44481
FT44481
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies