Top » Catalog » SNPs » A17819

$18.00

A17819
[A17819]

A17819
hg38 Position: ChrY:21315775..21315775
Ancestral: G
Derived: A
Reference: Alex Willimson (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A17819_F CTTCCACACTGGCTCATGG
Reverse Primer: A17819_R CAATAAATATTTAACTTCACTGATACTCTATATGC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
YFS2120222
YFS2120222
A17823
A17823
A17820
A17820
YFS2120220
YFS2120220
A17821
A17821
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies