Top » Catalog » SNPs » A17820

$18.00

A17820
[A17820]

A17820
hg38 Position: ChrY:21302515..21302515
Ancestral: G
Derived: C
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A17820_F AAATATCCCTATAAAAAAGTATTAGAATAAGTGG
Reverse Primer: A17820_R CTGGACACACCATCTTTAAGAACTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A17823
A17823
A17819
A17819
YFS2120220
YFS2120220
A17821
A17821
BY18204
BY18204
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies