Top » Catalog » SNPs » A17821

$18.00

A17821
[A17821]

A17821
hg38 Position: ChrY:19820758..19820758
Ancestral: T
Derived: C
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A17821_F CAAAAGACACTTGACCGCAG
Reverse Primer: A17821_R ATTAGGTTCTTTATTGTACCAGCTACTTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A17820
A17820
BY18204
BY18204
A17822
A17822
R1b-S603 OHare Panel
R1b-S603 OHare Panel
YFS2120244
YFS2120244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies