Top » Catalog » SNPs » A18726

$18.00

A18726
[A18726]

A18726
hg38 Position: ChrY:9120959..9120959
Ancestral: C
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105
Forward Primer: A18726_F CAGTGGCATGATTTCCACCT
Reverse Primer: A18726_R TGTGAAGATTGAGAAAAAAGGAGAC
Reviews

Customers who bought this product also purchased
DF104
DF104
BY81963
BY81963
FT252196
FT252196
BY35726
BY35726
YP4685
YP4685
BY35727
BY35727
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies