Top » Catalog » SNPs » A18726

$18.00

A18726
[A18726]

A18726
hg38 Position: ChrY:9120959..9120959
Ancestral: C
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105
Forward Primer: A18726_F CAGTGGCATGATTTCCACCT
Reverse Primer: A18726_R TGTGAAGATTGAGAAAAAAGGAGAC
Reviews

Customers who bought this product also purchased
DF85
DF85
A1775
A1775
S588
S588
A224
A224
S659
S659
A822
A822
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies