Top » Catalog » SNPs » A18726

$18.00

A18726
[A18726]

A18726
hg38 Position: ChrY:9120959..9120959
Ancestral: C
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105
Forward Primer: A18726_F CAGTGGCATGATTTCCACCT
Reverse Primer: A18726_R TGTGAAGATTGAGAAAAAAGGAGAC
Reviews

Customers who bought this product also purchased
FGC4133
FGC4133
P312
P312
FGC32795
FGC32795
DF49
DF49
ZS8379
ZS8379
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies