Top » Catalog » SNPs » A18726

$18.00

A18726
[A18726]

A18726
hg38 Position: ChrY:9120959..9120959
Ancestral: C
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105
Forward Primer: A18726_F CAGTGGCATGATTTCCACCT
Reverse Primer: A18726_R TGTGAAGATTGAGAAAAAAGGAGAC
Reviews

Customers who bought this product also purchased
DF13
DF13
M222
M222
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC46309
FGC46309
L21
L21
Y150210
Y150210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies