Top » Catalog » SNPs » A24003

$18.00

A24003
[A24003]

A24003
hg38 Position: ChrY:12613514..12613514
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24003_F GAACTGAAAAACACACCATGAGAG
Reverse Primer: A24003_R GGTTTCTGCCAAGGGATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies