Top » Catalog » SNPs » A24005

$18.00

A24005
[A24005]

A24005
hg38 Position: ChrY:13430799..13430799
Ancestral: C
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24005_F TAAGGCTGGAGTGCAATGTG
Reverse Primer: A24005_R TCCCTTGAATTTCTGTGGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies