Top » Catalog » SNPs » A24005

$18.00

A24005
[A24005]

A24005
hg38 Position: ChrY:13430799..13430799
Ancestral: C
Derived: G
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24005_F TAAGGCTGGAGTGCAATGTG
Reverse Primer: A24005_R TCCCTTGAATTTCTGTGGTTTC
Reviews

Customers who bought this product also purchased
A24001
A24001
A23998
A23998
A24013
A24013
A24011
A24011
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies