Top » Catalog » SNPs » A24010

$18.00

A24010
[A24010]

A24010
hg38 Position: ChrY:18945089..18945089
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24010_F TGGCCTGTGACACAGCC
Reverse Primer: A24010_R TAACTGAAAAGATATATTCTCCTCTGTCC
Reviews

Customers who bought this product also purchased
A24000
A24000
A23996
A23996
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies