Top » Catalog » SNPs » A24011

$18.00

A24011
[A24011]

A24011
hg38 Position: ChrY:19308953..19308953
Ancestral: G
Derived: C
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24011_F AACCTTGTGTTTTTGCAGTGG
Reverse Primer: A24011_R TTTCTGGGGAGGTAGTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30570
$18.00
Haplogroup Info
Other products
Currencies