Top » Catalog » SNPs » A24013

$18.00

A24013
[A24013]

A24013
hg38 Position: ChrY:20650845..20650845
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24013_F CTGTATAATAGCACAACAGGGACG
Reverse Primer: A24013_R GCCTGTAATCATATGATCTGGC
Reviews

Customers who bought this product also purchased
A23998
A23998
A24011
A24011
A24005
A24005
A24001
A24001
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies