Top » Catalog » SNPs » A24013

$18.00

A24013
[A24013]

A24013
hg38 Position: ChrY:20650845..20650845
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2705
Forward Primer: A24013_F CTGTATAATAGCACAACAGGGACG
Reverse Primer: A24013_R GCCTGTAATCATATGATCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30570
$18.00
Haplogroup Info
Other products
Currencies