Top » Catalog » SNPs » FGC4785

$19.00

FGC4785
[FGC4785]

FGC4785
hg38 Position: ChrY:20853680..20853680
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4785_F ACATTGAATCTATAAATAACCTTGGGTG
Reverse Primer: FGC4785_R CTAAACAGAGGTTGGAAGTTTTGC
Reviews

Customers who bought this product also purchased
FGC4781
FGC4781
FGC4756
FGC4756
FGC4768
FGC4768
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies