Top » Catalog » SNPs » HU669

$18.00

HU669
[HU669]

HU669
hg38 Position: ChrY:14563850..14563850
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2019)
ISOGG Haplogroup: J1
Comments: Below FGC5426
Forward Primer: HU669_F GGAGGATTCCTTCTTTTTCTGC
Reverse Primer: HU669_R GCTAGCAGAAGACATGAAATAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies