Top » Catalog » SNPs » YP5895

$18.00

YP5895
[YP5895]

YP5895
hg38 Position: ChrY:7928942..7928942
Ancestral: G
Derived: T
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: YP5895_F CAGGATCCGTTCCAGAGATG
Reverse Primer: YP5895_R CACAAGTTATGTGATATTTCAGACAGC
Reviews

Customers who bought this product also purchased
YP5894
YP5894
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies