Top » Catalog » SNPs » Z39655

$18.00

Z39655
[Z39655]

Z39655
hg38 Position: ChrY:17069431..17069431
Ancestral: A
Derived: G
Reference: Chris Rottensteiner (2016)
ISOGG Haplogroup: J2b
Comments: Below Z8429 (xCTS11760 Y12005)
Forward Primer: Z39655_F TGGCCCATCTTATATCTTCCTC
Reverse Primer: Z39655_R AAGGACACATTTCCTGTTTATTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies