Top » Catalog » SNPs » A9739

$18.00

A9739
[A9739]

A9739
hg38 Position: ChrY:16447272..16447272
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: unknown
Comments: Observed in I1-Z17928 and E-V13
Forward Primer: A9739_F TGGCTAATTTTTAATAGGGTCTCATTAC
Reverse Primer: A9739_R TGCACAGGTTTTGAAGAACATC
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Mail Tracking
Mail Tracking
A18844
A18844
S26015
S26015
Z5016
Z5016
Y172393
Y172393
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies