Top » Catalog » SNPs » S1194

$18.00

S1194
[S1194]

S1194
hg38 Position: ChrY:12556590..12556590
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L11. Parallel U106 P312. Upstream DF100 CTS4528
Forward Primer: S1194v2_F GAACTCTGAGGAGGGTGCAC
Reverse Primer: S1194v2_R GCATCTGCTGTAATTGTGTGGA
Reviews

Customers who bought this product also purchased
Y14069
Y14069
M9
M9
JFS0005
JFS0005
Z2103
Z2103
FGC12305
FGC12305
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies