Top » Catalog » SNPs » Y99196

$18.00

Y99196
[Y99196]

Y99196
hg38 Position: ChrY:15344267..15344267
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y99196_F TTCCAGGGGAGTGAGTGGT
Reverse Primer: Y99196_R TTTTGTTCTAAAAAAAATAAAGCAATTGTG
Reviews

Customers who bought this product also purchased
A1328
A1328
Y97246
Y97246
A811
A811
A14359
A14359
Y126296
Y126296
A22312
A22312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies