Top » Catalog » SNPs » BY140494

$18.00

BY140494
[BY140494]

BY140494
hg38 Position: ChrY:20584668..20584668
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below L26
Forward Primer: BY140494_F TTGGTCTACGGGACTATCAGG
Reverse Primer: BY140494_R TGGCCTTTAAATGGATGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies