Top » Catalog » SNPs » Y29724

$18.00

Y29724
[Y29724]

Y29724
hg38 Position: ChrY:14660804..14660804
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: J2
Comments: Below L26
Forward Primer: Y29724_F GCATGTGTGCGGTCAGTC
Reverse Primer: Y29724_R ATAGTGATTACATTTCTCCCTTCATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies