Top » Catalog » SNPs » Z35794

$18.00

Z35794
[Z35794]

Z35794
hg38 Position: ChrY:20696359..20696359
Ancestral: G
Derived: C
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2
Comments: Below L26
Forward Primer: Z35794_F TTTTTCTTCTGCCTGGTCTAGC
Reverse Primer: Z35794_R CGTGACAATCATGCTCTAAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies