Top » Catalog » SNPs » Y173624

$18.00

Y173624
[Y173624]

Y173624
hg38 Position: ChrY:22239349..22239349
Ancestral: C
Derived: A
Reference: Antonios Kollias (2019)
ISOGG Haplogroup: I2
Comments: Below L38 > BY25359 > Y125026 > Y128714 > Y130323
Forward Primer: Y173624_F GGTATTTCTAGTTATAGATCCTTGAAGAATCAC
Reverse Primer: Y173624_R AAAGCCAAATTTGACAAACGAGAC
Reviews

Customers who bought this product also purchased
Y173565
Y173565
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies