Top » Catalog » SNPs » PF7321

$18.00

PF7321
[PF7321]

PF7321
hg38 Position: ChrY:19695275..19695275
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2
Comments: Below M205
Forward Primer: PF7321_F CCAATCTTTTTCAAGGTTTTCC
Reverse Primer: PF7321_R GCTGTGGGTTTTGTATTCTTTTG
Reviews

Customers who bought this product also purchased
M241
M241
PH2514
PH2514
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2b-M12 Panel
J2b-M12 Panel
A11525
A11525
M12
M12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies