Top » Catalog » SNPs » PF7321

$18.00

PF7321
[PF7321]

PF7321
hg38 Position: ChrY:19695275..19695275
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2
Comments: Below M205
Forward Primer: PF7321_F CCAATCTTTTTCAAGGTTTTCC
Reverse Primer: PF7321_R GCTGTGGGTTTTGTATTCTTTTG
Reviews

Customers who bought this product also purchased
M12
M12
PH4306
PH4306
BY173962
BY173962
CTS7683
CTS7683
M205
M205
Y22063
Y22063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies