Top » Catalog » SNPs » A24569

$18.00

A24569
[A24569]

A24569
hg38 Position: ChrY:6727744..6727744
Ancestral: C
Derived: A
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24569_F CTGCATAGGATTTGTTATACCATTTC
Reverse Primer: A24569_R AAGATAATCTACATCAGTTTCTTTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies