Top » Catalog » SNPs » A24572

$18.00

A24572
[A24572]

A24572
hg38 Position: ChrY:8330770..8330770
Ancestral: G
Derived: A
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24572_F AGATGTTGACTAAAAAACCTGGGG
Reverse Primer: A24572_R AAGTCTCAAAACTGGGGCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies