Top » Catalog » SNPs » A24573

$18.00

A24573
[A24573]

A24573
hg38 Position: ChrY:8548370..8548370
Ancestral: A
Derived: T
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24573_F TGCATTCCAGGTTGTGGTG
Reverse Primer: A24573_R TGTGTTGTTGAGTGTTCTTTTGGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies