Top » Catalog » SNPs » A24575

$18.00

A24575
[A24575]

A24575
hg38 Position: ChrY:11878341..11878341
Ancestral: G
Derived: C
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24575_F CTAAAATTCAATGTTGAAATTCTTACTCTG
Reverse Primer: A24575_R AGGCTGGAAGTCTGGTATAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies