Top » Catalog » SNPs » A24576

$18.00

A24576
[A24576]

A24576
hg38 Position: ChrY:11899011..11899011
Ancestral: C
Derived: T
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24576_F GTGTCAAGACTTCACAGCTGAAG
Reverse Primer: A24576_R CACATTTTCTTTATCCAGTCTATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies