Top » Catalog » SNPs » A24577

$18.00

A24577
[A24577]

A24577
hg38 Position: ChrY:14208607..14208607
Ancestral: A
Derived: C
Reference: Timofey Kalinin (2019)
ISOGG Haplogroup: R1a
Comments: Below BY32105
Forward Primer: A24577_F AATATTAACCTAAAATGTAAATGGGCTATG
Reverse Primer: A24577_R TTCTGTTCTTTTCCAATTGCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies