Top » Catalog » SNPs » Y152662

$18.00

Y152662
[Y152662]

Y152662
hg38 Position: ChrY:8167875..8167875
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z326 > Y21406
Forward Primer: Y152662_F CCTTTTAAACTTGACACAAGCACTG
Reverse Primer: Y152662_R GTCAAATGGTGTAATTAAAAGTCTTCAC
Reviews

Customers who bought this product also purchased
Y139319
Y139319
DNA Sample Kit
DNA Sample Kit
BY164761
BY164761
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies