Top » Catalog » SNPs » Y152662

$18.00

Y152662
[Y152662]

Y152662
hg38 Position: ChrY:8167875..8167875
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z326 > Y21406
Forward Primer: Y152662_F CCTTTTAAACTTGACACAAGCACTG
Reverse Primer: Y152662_R GTCAAATGGTGTAATTAAAAGTCTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies