Top » Catalog » SNPs » A16570

$18.00

A16570
[A16570]

A16570
hg38 Position: ChrY:20487923..20487923
Ancestral: C
Derived: T
Reference: William Hartley (2017)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 Z2535+ L338,YSC261+ S12289+
Forward Primer: A16570_F GACCCAAAACCAAATGCAAC
Reverse Primer: A16570_R CTCTGGTTGTGTCATGAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies