Top » Catalog » SNPs » FT61258

$18.00

FT61258
[FT61258]

FT61258
hg38 Position: ChrY:9017137..9017137
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT61258_F CAAAAGCCAAACGTGACTGG
Reverse Primer: FT61258_R ATGAAGACAGACGATACAGAAGGC
Reviews

Customers who bought this product also purchased
FT61468
FT61468
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies