Top » Catalog » SNPs » BY14642

$18.00

BY14642
[BY14642]

BY14642
hg38 Position: ChrY:8287343..8287343
Ancestral: T
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R2a2a1a1a1a
Comments: Below FGC13211
Forward Primer: BY14642_F TGGAGGAGTAGTAATGCCAGGG
Reverse Primer: BY14642_R AATATGCTTAAAAATAAAGTAAGAAAACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies