Top » Catalog » SNPs » JFS0121

$18.00

JFS0121
[JFS0121]

JFS0121
hg38 Position: ChrY:19308712..19308712
Ancestral: T
Derived: A
Reference: Michael Sager & John Sloan (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U198 > DF93 > S4056
Forward Primer: JFS0121_F CTTGTAACAGGGCATTGCTG
Reverse Primer: JFS0121_R GCACTGATGGTGGAAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies