Top » Catalog » SNPs » Y44781

$18.00

Y44781
[Y44781]

Y44781
hg38 Position: ChrY:2856494..2856494
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below M420 > YP4151 > Y168233
Forward Primer: Y44781_F GCTGGAGAGTGGGTAGGTAGG
Reverse Primer: Y44781_R AAACCTTTGCCCTCACTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies