Top » Catalog » SNPs » Y129780

$18.00

Y129780
[Y129780]

Y129780
hg38 Position: ChrY:3000801..3000801
Ancestral: A
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > BY32105
Forward Primer: Y129780_F GCATCTAAATTGTAAAAGATTAATGAAATC
Reverse Primer: Y129780_R CAGAAGTTTCTAATTTTGTCCAGCTTAC
Reviews

Customers who bought this product also purchased
BY164730
BY164730
Y128623
Y128623
BY32105
BY32105
L260
L260
BY82357
BY82357
Y74045
Y74045
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies