Top » Catalog » SNPs » Y129780

$18.00

Y129780
[Y129780]

Y129780
hg38 Position: ChrY:3000801..3000801
Ancestral: A
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > BY32105
Forward Primer: Y129780_F GCATCTAAATTGTAAAAGATTAATGAAATC
Reverse Primer: Y129780_R CAGAAGTTTCTAATTTTGTCCAGCTTAC
Reviews

Customers who bought this product also purchased
FGC66342
FGC66342
YP619
YP619
YP4648
YP4648
Y74045
Y74045
L1029
L1029
YP416
YP416
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies