Top » Catalog » SNPs » FGC63890

$18.00

FGC63890
[FGC63890]

FGC63890
hg38 Position: ChrY:7160855..7160855
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC63890v2_F GAAGTTTTCACTTACTTTTCTGGTGTG
Reverse Primer: FGC63890v2_R CAGAATCATGCCTATAGTTAACAATACAG
Reviews

Customers who bought this product also purchased
FGC63914
FGC63914
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY8338
$18.00
Haplogroup Info
Other products
Currencies