Top » Catalog » SNPs » FGC63914

$18.00

FGC63914
[FGC63914]

FGC63914
hg38 Position: ChrY:22729120..22729120
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC63914_F GTCCGCAATACCACAGGC
Reverse Primer: FGC63914_R TCCACTTCTTGGATACAAGCG
Reviews

Customers who bought this product also purchased
FGC63890
FGC63890
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies