Top » Catalog » SNPs » FGC1608

$18.00

FGC1608
[FGC1608]

FGC1608
hg38 Position: ChrY:5562667..5562667
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1608_F GTAATAAACTATTGGCCGGGTG
Reverse Primer: FGC1608_R GTCTCGCTCTGTCGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies