Top » Catalog » SNPs » A24938

$18.00

A24938
[A24938]

A24938
hg38 Position: ChrY:9232086..9232086
Ancestral: G
Derived: A
Reference: Noah Meek (2019)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A24938_F GTGTATGTCTCTTAAAATGAGCAATGG
Reverse Primer: A24938_R GCTGGAGTTCAGTGGCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies