Top » Catalog » SNPs » ZS4737

$18.00

ZS4737
[ZS4737]

ZS4737
hg38 Position: ChrY:19394410..19394410
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4737_F CGGTAAATACCTATTCTATTTTTCTTAGGTTAG
Reverse Primer: ZS4737_R AAAAATTTCTGGCCTTGCTG
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS4727
ZS4727
BY68843
BY68843
FGC11
FGC11
BY16791
BY16791
ZS11995
ZS11995
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies